Posted on

Qualitative Analysis of Oligonucleotides Using The Advion Interchim Scientific® HPLC-UV/MS System

Instrumentation
Mass Spec: expression® Compact Mass Spectrometer (CMS)
HPLC: AVANT®

Introduction

Oligonucleotides have gained significant attention in biopharmaceutical development due to their
ability to modulate gene or protein expression. Their clinical success is evident with the approval of several oligonucleotide-based drugs or their advancement into clinical trials.[1] These drugs include antisense oligonucleotides, small interfering RNA (siRNA) therapeutics, and mRNA-based vaccines, exemplified by the successful development of COVID-19 vaccines. Such accomplishments have spurred further interest and investment in oligonucleotide research and development.

Solid-phase synthesis is a commonly used method to produce oligonucleotide sequences. The raw material is typically purified through various techniques, such as desalting, ultrafiltration, solid-phase extraction (SPE), high-performance liquid chromatography (HPLC), or preparative liquid chromatography (prepLC), depending on the desired purity level. Ion-pairing HPLC or prepLC methods are often preferred as they offer higher purity compared to other techniques.

This application note aims to demonstrate the HPLC/UV analysis of multiple oligo samples and utilize HPLC/CMS analysis to determine their molecular weight.

Method

HPLC-UV/CMS System
With a quaternary pump and column selection valve, the process of switching between different buffers and columns for various analyses becomes remarkably straightforward, eliminating the need for manually
removing the column and changing the solvent. This automation greatly enhances efficiency and convenience in the analytical process.

Table 1: Item Instrument List


Oligo(dT) 12-18 primer
Oligo(dT) 12-18 primer (Thermos Fisher Scientific, MA) was used to check the HPLC method for oligonucleotides analysis.

The separation of these Oligo(dT) 12-18 primer was carried out using an ion-pair reverse phase HPLC method with an Interchim Uptisphere Strategy 5 μm C18HQ column 250 x 4.6 mm. A 10 μL aliquot was injected for all analyses, and the column temperature was maintained at 30°C. The mobile phase A composition was 100 mM TEAA in water, while mobile phase B is acetonitrile. And the flow rate is 1 ml/min.

The HPLC analysis proceeded as follows: After injection of the sample, mobile phase B was set at 10% for 1 minute. It was then linearly increased to 15% over 24 minutes. At 25.1 minutes, it increased to 95% and kept at this level for 2.4 minutes to clean the column. Subsequently, at 27.6 minutes, it reduced to 10% and maintained for 2.4 minutes for column equilibration.

Figure 1 illustrates that the HPLC method effectively separates the seven Oligo(dT) 12 to 18 primers.

Figure 1: HPLC/UV analysis of Oligo(dT)12-18


RNA Standard with 4 components
The RNA oligonucleotides mixture (Aglient Technologies, CA ) was prepared by diluting it 10 times with DI water before HPLC analysis. The sequences of four RNA standards are as follows: 14 mer (CACUGAAUACCAAU), 17 mer (UCACACUGAAUACCAAU), 20 mer (UCAUCACACUGAAUACCAAU), and 21 mer (GUCUCAUCACACUGAAUACCAAU).

The separation of these RNA samples was conducted using a similar HPLC method as that for oligo(dT)12-18 primers, with slight modifications.

The HPLC analysis proceeded as follows: After injection of the sample, mobile phase B was set at 9% for 1 minute. It was then linearly increased to 10% over 24 minutes. At 25.1 minutes, it increased to 95% and kept at this level for 2.4 minutes to clean the column. Subsequently, at 27.6 minutes, it reduced to 9% and maintained for 2.4 minutes for column equilibration.

Figure 2 illustrates that the HPLC method effectively separates the four RNA samples, even with a 1-mer difference between the 20-mer and 21-mer RNA samples. This baseline separation for the 20-mer and 21-mer is crucial for analyzing synthetic oligonucleotides, as most impurities during synthesis are typically N=1 mer or N+1 mer.[2]


ssDNA Samples
Three single-strand DNA samples (ssDNA) with 17 mer (GTCAGCAAGGACATCGT), 18 mer(CATTTGAGTAGCCAACGC), and 19 mer (GGACACTTTCATGCGAGTT) were also tested using the modified HPLC method from that used for RNA samples.

The concentration of each ssDNA was 30 μM, and 10 μL aliquots were loaded onto the column for analysis. The HPLC analysis was performed using the following gradient: After the sample injection, mobile phase B (MPB) was set at 9% for 1 minute, then linearly increased to 15% over 24 minutes. At 25.1 minutes, it increased to 95% and maintained at this level for 2.4 minutes to clean the column. At 27.6 minutes, the MPB was reduced to 9%, and this level was maintained for 2.4 minutes for column equilibration. The flow rate for the analysis was set to 1.5 ml/min. Despite the greater change in solvent B per minute compared to the RNA samples, Figure 3 demonstrates that the method effectively separates the three ssDNA samples with good baseline resolution.

Figure 3: HPLC/UV analysis of three ssDNA samples 1-3, three single strand DNA samples with ssDNA-1: 17 mer (GTC AGC AAG GAC ATC GT); ssDNA-2: 18 mer (CAT TTG AGT AGC CAA CGC) and ssDNA-3: 19 mer (GGA CAC TTT CAT GCG AGT T).


Purity Analysis of a ssDNA Sample
With a same method used for ssDNA samples shown in figure 3, it was also employed for the purity analysis of an ssDNA sample: 19 mer (5’-TGGCGGGCGTACCTGGACT-3’).

Figure 4 reveals that the 19-mer ssDNA 4 has a UV purity of 74.3% at 260 nm that was determined using Advion Data Express software.


MS Analysis of ssDNA sample used in F.5 purity analysis
The HPLC/MS analysis of oligonucleotides was performed using an Advion AVANT® HPLC system coupled with an Advion Expression® CMS-L. For MS analysis, the Interchim Uptisphere Strategy 2.6 μm C18-HQ column with dimensions 50 x 2.1 mm was used, with a flow rate of 0.2 ml/min. The column temperature was set to 55°C.

Compared to the use of TEAA for the mass analysis of oligonucleotides, the ion pair reagents combining TEA and HFIP offer significantly improved performance. Therefore, this application note will focus on employing TEA and HFIP ion pair reagents for the HPLC/MS analysis of oligonucleotides.

The mobile phase consisted of 15 mM TEA and 10 mM HFIP in water as mobile phase A, and methanol as mobile phase B. The total HPLC run time was 25 minutes, starting with 5% of solvent B for 1 minute.
The percentage of B was then increased to 6% over 14 minutes, followed by an increase to 95% at 15.1 minutes that was kept for 2.9 minutes to elute the compounds of interest. Subsequently, the % B was reduced to 5% and kept at this level for 6.9 minutes to equilibrate the column before the next analysis.

The MS analysis was conducted in negative ESI mode with the MS scan range set from 500 to 2000 Da. Figure 5b shows the MS spectra of ssDNA-4, displaying a charged envelope with peaks at m/z 1463.9 (4-), 1170.8 (5-), (975.8 (6-), 936.0 (7-), 731.8 (8-), and 650.2 (9-). Through charge deconvolution in Data Express, the uncharged mass for the ssDNA sample was determined to be 5861.8 Da, which closely matches the theoretical value of 5860.8 Da.

Figure 5: HPLC/MS analysis of ssDNA-4 (5-TGG CGG GCG TAC CTG GAC T-3), MW 5860.8 Da


Figure 6: HPLC/MS analysis of ssDNA-5 (5-GGGTGG-CAT-TAT-GCT-GAG-T-3), mw 5914.9


MS Analysis of a Further Example Sample
The MS spectra of ssDNA-5 (5’-GGG-TGG-CAT-TATGCT-GAG-T-3’) are depicted in Figure 6, showing a charged envelope with peaks at m/z 1477.8(4-), 1182.1(5-), 984.7(6-), 843.8(7-), and 738.2(8-). By charge deconvolution the uncharged mass for the ssDNA-5 was determined to be 5913.9, which is in close agreement with the theoretical value of 5914.9.

Conclusion

Using a 5 μm particle size C18HQ column coupled with TEAA (Triethylammonium acetate) ion-pairing reagent has been demonstrated to be suitable solution for oligonucleotide HPLC analysis.

For MS analysis of Oligonucleotides, the same C18HQ column can be employed with HFIP (hexafluoroisopropanol) and TEA (triethylamine) as the ion-pairing reagent in conjunction with an AVANT® HPLC-UV/CMS system. This method has been proven to yield additional accurate mass measurements of Oligonucleotides.

Overall, utilizing the Interchim C18HQ column and the appropriate ion-pairing reagent in combination with the AVANT® HPLC-UV and -CMS system can provide a reliable solution for the purity analysis and characterization of oligonucleotides.

References
[1]Roberts, T.C., Langer, R. & Wood, M.J.A. Advances in oligonucleotide drug delivery. Nat Rev Drug Discov 2020, 19, 673–694
[2]Martina C. et.al. Oligonucleotides: Current Trends and Innovative Applications in the Synthesis, Characterization, and Purification, Biotechnology J. 2020, 1900226

Posted on

The Extraction, Identification, Purification and Quantitation of Cyanidin-3-Glucoside in Black Rice

Instrumentation
Flash: puriFlash® 5.250, XS-Vap®
Mass Spec: expression® Compact Mass Spectrometer (CMS)
HPLC: AVANT™

Introduction
Rice is one of the more essential foods in the world, especially in Asian countries. Amongst the pigmented rice varieties, black rice has received increasing attention because of its high nutritive value and beneficial health properties. Black rice is an anthocyanin enriched pigmented rice that contains Cyanidin-3-glucoside (Cyn-3-Glu), Cyanidin-3-rutinoside (Cyn-3-Rut), Peonidin-3-glucoside (Pn-3-Glu) and other anthocyanins. Cyanidin-3-glucoside is the dominant anthocyanin in black rice.

This application note shows how Cyanidin-3-glucoside is extracted from black rice and purified with a prepLC/Flash system. The amount and purity of Cyn-3-Glu is measured utilizing a certified reference standard.

Method
Cyanidin-3-glucoside Extraction
Black rice was purchased from a local grocery store, ground into fine powder with a spice grinder, and extracted with the following method:
1. 30 grams of the ground black rice was mixed with 200 mL of methanol acidified with 1.0 N HCl (85:15, v/v) and sonicated for 15 min.
2. The mixture was centrifuged at 7500 rpm at 4°C for 5 min. The supernatant was decanted into a clean flask. The pellet was extracted again with 200 ml of methanol acidified with 1.0 N HCl (85:15, v/v), and sonicated for 15 min.
3. Supernatant from the two extractions was combined and reduced to 25 ml using a rotatory evaporator.
4. A small part of the concentrated extract was diluted 10x with water for HPLC/UV/MS analysis, the rest was loaded directly on a PrepLC/Flash system for purification.

Analytical HPLC/UV/MS Setup
Table 1: Analytical HPLC/UV/MS method for the black rice extract.

Analytical HPLC/MS Analysis of Black Rice Extract
The concentrated extract of black rice was diluted 10x with distilled water for HPLC/CMS analysis.

With mass range from 200 to 800 Da, HPLC/MS chromatogram is shown in Figure 1a. The average MS spectrum from the peak at 12.10 min is shown in Figure 1b with a single ion at m/z 449.2 detected in the positive ESI mode. The MS spectrum with in-source CID is shown in Figure 1c showing a confirmative fragment ion at m/z 287.0

Figure 1: A). The HPLC/MS Chromatogram of black rice extract, B). The average mass spectra of peak at 12.10 min, C). The average mass spectra of peak at 12.10 min with in-source CID at 30V.

MS Spectra Database Search
Through the MS spectra database search in Advion Data Express, the compound eluted at 12.1 min is confirmed as Cyanidin-3-glucoside (Cyn-3-Glu).

Figure 2: Library search result of the average MS spectra in Figure 1c extract.

Peak Express Software Helps to Detect other Anthocyanin
The Peak Express™ software implemented in Data Express can dynamically determine the rate of change of intensity and standard deviation of all ions being detected and only display the ions that exceed a preset threshold setting.

Peak Express™ helps to detect another peak at 14.41 min in the ΔIC chromatogram (Figure 3b) that is barely indicated in its TIC chromatogram (Figure 3a). ΔS Delta Spectrum with the in-source CID shows two ions detected at m/z 463.3 and 301.1.

MS spectrum database search determines that it is Peonidin-3-O-glucoside (Search result is shown in Figure 4).

Figure 3: A). The HPLC/MS chromatogram of black rice extract, B). The ΔIC chromatogram of black rice extract C). The ΔS Delta Spectrum of peak at 14.41 min with in-source CID at 30V

Figure 4: The library search result of the ΔS Delta Spectrum in Figure 3c

HPLC/UV Analysis of Black Rice Extract
The black rice extract was also analyzed by HPLC/UV. Two characteristic UV absorption peaks of Cyn-3-Glu at 12.01 min are found at 278 nm and 518 nm (Figure 5b).

520 nm is used to trigger the fraction collection in the purification with a PrepLC/Flash system.

Figure 5: A). The HPLC/UV chromatogram of black rice extract, B). The UV absorbance profile from peak at 12.07 min

PrepLC Method for cyn-3-glu Purification
Table 2: PrepLC method for Cyn-3-Glu purification

Purification
Black rice extract purifications are performed on an Advion Interchim Scientific puriFlash® 5.250 PrepLC/Flash system.

The detail information of solvents and separation method is listed in the method table. Typical PrepLC/UV chromatogram of the black rice extract (3 ml sample) is shown in Figure 6.

Each fraction collected is additionally analyzed by HPLC-UV/MS to confirm identification and provide additional purity analysis.

Figure 6: The prepLC chromatogram (520 nm) of black rice extract on puriFlash® 5.250 PrepLC/Flash system

HPLC/UV Analysis of Fraction 2, 5 and 8
All fractions are analyzed by HPLC/UV/MS. HPLC/MS analysis of fraction 1 shows an impurity with the m/z 611, and low UV response of Cyn-3-Glu. And fractions 2-8 have a purity of more than 97.6 %. The HPLC/UV chromatograms of fraction 2, 5 and 8 are used as examples shown in Figure 7 with purities of 97.6% for 2, 100% for fraction 5 and 8.

Except for the first fraction, all fractions were combined for dryness. The drying of fractions was performed on an Advion Interchim Scientific puriFlash® XS-Vap system at room temperature. The weight of Cyn-3-Glu purified from 30g black rice is 25.8 mg.

Figure 7: The HPLC/UV chromatogram of fractions a) Fraction 2, b) Fraction 5, c) Fraction 8.

Quantitation of C3G by HPLC/UV
To confirm the final purity of the dried sample, a certified reference standard of Cyn-3-Glu was used for the quantitative analysis of dry Cyn-3-Glu to check its purity. HPLC calibration curve of Cyn-3-Glu reference is shown in Figure 8.

The measured amount of Cyn-3-Glu is 25.5 mg with a purity of 99.0%.

Figure 8: HPLC/UV calibration curve of Cyn-3-Glu reference standard

Conclusion
With the developed HPLC/UV/MS and PrepLC methods, Cyn-3-Glu in black rice extract can be separated, purified, and quantified.

25.5 mg of Cyn-3-Glu was purified from 30g black rice with a purity of 99.0%.
Combination of Interchim PrepLC/Flash and Advion HPLC-UV/CMS is a simple and cost-effective solution for extracting and purifying Cyn-3-Glu from rice sample or samples containing Cyn-3-Glu.

Following this general workflow:

HPLC/CMS provides a simple way for the identification and purity analysis of target compounds in natural product purification.

Posted on

Purification of Bioactive Peptides from Complex Mixtures using the puriFlash® 5.250 PrepLC and expression® CMS Detector

Instrumentation
Mass Spec: expression® CMS
Flash: puriFlash® 5.250 prepLC
HPLC: AVANT®

Author
Changtong Hao
Advion Interchim Scientific

Introduction
In recent years, biopharmaceutical companies have increasingly embraced peptide/protein-based drugs due to their enhanced specificity and selectivity compared to traditional small molecule drugs. However, the purification of peptides/proteins during the drug discovery process is crucial to ensure the safety and efficacy of the final product. Attaining the highest possible purity levels for the bioactive target compounds is essential in minimizing the risk of toxicity and complying with regulatory standards.[1,2]

Whey protein isolate, a by-product of cheese production, contains various glycomacropeptides and two significant bioactive peptides, casein macropeptide A (CMPa) with a molecular weight (MW) of 6757 Da and casein macropeptide B (CMPb) with a MW of 6787 Da. Extracting and purifying individual components, such as casein
macropeptide, is essential for investigating their bioactivity.[3]

In this application note we use whey protein isolate and two casein macropeptides as an example to demonstrate the isolation and purification of bioactive components with a system comprised of a puriFlash® 5.250 prepLC coupled online to an expression® CMS detector. This combination offers higher selectivity and sensitivity compared to traditional detectors such as UV or ELSD, which may not effectively respond to bioactive target peptides and proteins.


Advion Interchim Scientific
puriFlash® 5.250


Advion Interchim Scientific
expression® CMS

Method
Preparation of Whey Protein Isolate
• The casein macropeptide isolation procedure used in this application is based on Tadao Saito’s work[4] with some modifications.
• A 50 g sample of whey protein isolate purchased from local grocery store was combined with 500 mL of a solvent mixture of 70% water and 30% methanol (v/v). The mixture was sonicated at 70°C for 90 minutes and then filtered under reduced pressure.
• The resulting filtrate was concentrated to a volume of 300 mL by removing methanol using a rotary evaporator under reduced pressure at 40 °C. It was then stored at 4°C for one hour. Subsequently, an equal volume of cold ethanol was added to the solution, and the mixture was vortexed for 5 minutes before being stored at 4°C for an additional 4 hours.
• The mixture was filtered under reduced pressure using a 0.5 μm filter. The final filtrate was then concentrated to a volume of 50 mL using a rotary evaporator under reduced pressure.
• A 100 μL aliquot of the concentrated extract was mixed with 900 μL of deionized (DI)
water for analytical HPLC/MS analysis.
• The remaining filtrate was used for peptide purification using the puriFlash® 5.250 PrepLC system coupled with an expression® CMS detector.

Table 1: Analytical HPLC/MS Method Setup

Analytical HPLC/MS Method Setup
The liquid extract from whey protein isolate was first analyzed using an AVANT® HPLC/CMS system and a chromatography separation method developed for the 4.6 mm column used (Table 1).

Figure 1a shows the HPLC/MS chromatogram of the liquid extract. The averaged MS spectra from the peak at 6.44 min indicates that the compound is a multiply charged peptide with at least five masses at m/z 755.2, 849.4, 970.6, 1132.1, and 1358.6 (Figure 1b) forming a charge profile.

Through software charge deconvolution, the uncharged mass of the peptide was determined to be 6787.4 Da, indicating casein macropeptide B (CMPb, theoretical mass of 6787 Da) (Figure 1c).


Advion Interchim Scientific
AVANT® (U)HPLC


Figure 1: (a) HPLC/MS chromatogram of liquid extract from whey protein isolate, (b) The averaged MS spectra from peak at RT 6.44 min, (c) The deconvoluted, uncharged mass of the peptide eluting peak at RT 6.44 min.


Figure 2: (a) HPLC/MS chromatogram of liquid extract from whey protein isolate, (b) The averaged MS spectra from peak at RT 11.02 min, (c) The deconvoluted, uncharged mass of the peptide eluting at RT 11.02 min.

The averaged MS spectra obtained from the peak eluting at 11.02 min suggest that the compound is also a multiply charged peptide with masses at m/z 751.5, 845.4, 966.1, 1126.8, and 1352.1 (Figure 2b) forming its charge profile.

Similarly, charge deconvolution determines the uncharged mass of this peptide to be 6755.3 Da indicating the A variant of casein macropeptide, CMPa with a theoretical mass of 6755 Da (Figure 2c).


Advion Interchim Scientific
puriFlash® 5.250, MS Splitter and expression® CMS

PrepLC/MS Chromatography
In a next step, the analytical separation method was transposed to the larger prep scale from 4.6 mm column ID to 30 mm ID column ID and further optimized for the purification of the two CMPs (casein glyco-macropeptides) on the puriFlash® 5.250 PrepLC/Flash system coupled online to the expression® CMS detector.

The PrepLC-UV/MS chromatogram of the whey protein isolate is shown in Figure 3 and parameters shown in Table 2.

Fraction collection was triggered based on the MS signal, chosen for its higher selectivity and sensitivity. XIC of 970-971 Da was used to detect CMPb, and XIC of 965-966 Da for CMPa.

The organic solvent in the combination of fractions 11-17 and fraction 18-22 was removed using a rotary evaporator under negative pressure, and the remaining aqueous
solution was dried using a LABCONCO Freezone 2.5L (-50 C) lyophilizer, resulting in a dry collection of 10 mg each, which was then dissolved in 10 ml of deionized water for subsequent HPLC/UV/MS analysis. The results of the purity analysis are shown in figures 4 and 6.

Table 2: PrepLC/MS Method Setup


Figure 3: The PrepLC-UV/MS chromatogram of two whey protein isolate

Results

Purity Analysis of CMPb
Purity analysis of CMPb in the pooled fractions 11 to 17 is shown in Figure 4. MS analysis shows that four major ions were detected with m/z at 970.8, 1132.3, 1358.6 and 1968.2 (Figure 4b).

With the averaged mass spectra from Figure 4b, the uncharged mass of the peak at 5.94 min was determined to be 6788.4 (CMPb, Figure 4c). However, MS analysis can also detect four minor components at 6758.3, 6773.5, 6804.8 and 6868.4 Da.

The obtained UV purity of CMPb is 86.7% (Figure 4d), but, based on the additional MS data, the compound purity is actually less then that (estimated 80%).

CMPa in the pooled fractions 18 to 22 was measured to be 94.7% (figure 5a) based on UV analysis of the analytical run.

The deconvoluted uncharged mass analysis shows the expected dominant mass 6756.2 of CMPa (figure 5b), and one minor component at 6774.6, an oxidized form of CMPa.

Again, this example shows the value of MS detection of bioactive compounds such as peptide and proteins, and the better specificity of MS detection compared to UV.


Figure 4: (a) The HPLC-MS chromatogram of pooled fractions of 11-17, (b) Averaged MS spectra of peak eluting at RT 5.94 min, (c) the uncharged mass from (b), (d) The HPLCUV chromatogram of pooled fractions of 11-17.


Figure 5: (a) The HPLC-UV chromatogram of pooled fractions of 18-22. (b) deconvoluted uncharged mass of CMPa.

The final overall purity is estimated to be ca. 90%, an excellent value for a bioactive molecule in drug discovery.

Further improvement in purity can be achieved with selective fractions – at the cost of yield. For example, the HPLC-UV/MS analysis of fraction 20 of CMPa (Figure 6a) shows a UV purity of 99.0% (Figure 6d) and no oxidized by-product in the MS analysis.


Figure 6: (a) The HPLC-MS chromatogram of fraction 20, (b) Averaged MS spectra of peak at RT 5.71 min, (c) deconvoluted uncharged mass of CMPa (d) The HPLCUV chromatogram of fractions 20.

Conclusion
The puriFlash® 5.250 PrepLC/Flash system, coupled on-line with an expression® CMS detector, achieves outstanding performance, facilitating the selective purification of bioactive macropeptides from a complex matrix with high level of confidence. Compared to UV or ELSD detectors, the mass spectrometer delivers superior selectivity and sensitivity.

An illustrative application of this approach shows the isolation of casein glycol-macro-peptides, resulting in a purity range of 80% (CMPb) to 90% (CMPa) through combined fractions with high yield. Even higher purity of up to 99.0% can be achieved with selective fractions.

 

REFERENCES

[1]Gräslund, S., et al. (2008). Protein production and purification. Nature methods, 5(2), 135-146.
[2]Biopharmaceutical Processing: Development, Design, and Implementation of Manufacturing Processes.
[3]Lin T., et al. (2021) Bioactives in bovine milk: chemistry, technology, and applications Nutrition Reviews v79(S2):48–69
[4]Saito T., er al. (1991) A new isolation method of caseinoglycopeptide from sweet cheese whey. J. Dairy Sci. 74, 2831-2837

Posted on

Blood Analysis using the Advion Interchim Scientific SOLATION® ICP-MS

Introduction

Trace elements are essential for proper biological functions in humans, and differing levels of trace elements are indicative of many diseases and conditions. Non-essential trace elements are also present in the human body as a result of environmental contaminants generated by human or industrial activities deposited in soil, air, water, and foodstuffs. These essential and non-essential trace elements are easily measured and monitored in blood, serum, and urine using ICP-MS.

In this application note we present a fast method for routine analysis of small volume blood samples for key toxic and essential elements using the SOLATION® Inductively Coupled Plasma Mass Spectrometer (ICP-MS) using a simple “dilute and shoot” sample preparation. The high sensitivity and wide dynamic range of ICP-MS are particularly important for the determination of trace levels of heavy metals, while simultaneously measuring nutritionally relevant elements at higher levels. Blood is a complex matrix, rich in proteins and salts that favor the formation of carbon- and chlorine-based interferences that affect many of the analytes. The collision cell on Advion Interchim Scientific’s SOLATION® ICP-MS is necessary for overcoming those interferences.

The SOLATION® ICP-MS has an octupole collision cell that is used for addressing interferences from polyatomic ions, especially for the transition metal elements. It is critical for robust and routine trace element analysis that the octupole cell does not become contaminated which could cause drift and unnecessary downtime. Ions passing through the interface are directed through a 90˚ turn and focused onto the entrance of the octupole using a quadrupole deflector (QD). Light and neutral particles continue through the QD and away from the cell.

The collision cell in the SOLATION® ICP-MS can be operated in “He Gas” mode in which the cell is filled with He to act as a collision gas, or in “No Gas” mode in which the cell is empty. The “He Gas” mode is used for isotopes subject to polyatomic interferences while the “No Gas” mode is used for the rest of the isotopes. The rapid switching between “He Gas” and “No Gas” modes on the SOLATION® (< 5 sec) ensures that analytical runs can be kept short, thereby improving productivity.

Experiment & Results

Reagents & Materials

Nitric acid (Aristar Plus, trace metal grade)
Triton X-100 (especially purified, Roche chemical)
Water, type 1 (18.2 MΩ, Elga point of use system)
Methanol (hypergrade for LC-MS, Supelco)
Mg, Ca, Mn, Cu, As, Se, Cd, Pb, Ge, Rh, Au, and Ir standard solutions (1000 μg/ml, Claritas ppt grade) 
Trace Elements Whole Blood L-1 (SRM1) (Seronorm)
Trace Elements Whole Blood L-2 (SRM2) (Seronorm)
Trace Elements Whole Blood L-3 (SRM3) (Seronorm)
Blank Whole Blood (WB(F)) (UTAK)
Acid diluent: (0.5% Nitric acid, 0.05% Triton X-100, 2% Methanol, 0.25 μg/mL (ppm) Au, and the internal standards: 10 μg/L (ppb) Ge, Rh, and Ir)

Table 1: Calibration and standard concentrations

Standards

The method was developed to determine Mg, Ca, Mn, Cu, As, Se, Cd, and Pb in whole blood samples. The elements were chosen to represent some of the commonly measured metals in blood, covering both essential and toxic elements. Standards were prepared using the acid diluent with elements at four concentration levels to cover the range typically seen in blood. Table 1 outlines the standard concentrations at each level and which elements are at that level. The analysis mode and the internal standard used for each analyte are in Table 2. The ICH guidelines call for a minimum of five concentrations to establish linearity; with the calibration blank we use six, satisfying this requirement.

Table 2: Analysis Mode and Internal Standards

Samples & Preparation

Samples were prepared in 15mL, metal-free centrifuge tubes. Acid diluent (14.7mL) was added to each tube, followed by 0.3mL blood sample for a 1:50 dilution. The tubes were capped and inverted 3-5 times to thoroughly mix.

The samples were analyzed using a SOLATION® ICP-MS. The SOLATION® instrument configuration for this analysis was a cyclonic spray chamber with a Micromist concentric nebulizer and a one-piece torch. Ni sampler and skimmer cones were used throughout the study. The running conditions for the instrument are summarized in Table 3.

Table 3: ICP-MS Operating Parameters

Results & Discussion

We followed the ICH “Validation of Analytical Procedures” guidelines for method validation which defines specific requirements for accuracy, precision (repeatability), detection limit and method detection limit (DL and MDL), and quantitation limits (LOQ). 

The accuracy of the method was established using the Seronorm reference materials, which had certified concentration values for all the elements in the method. These materials were measured in triplicate and the analytical results were compared to the certified values and 95% confidence limits provided by Seronorm. 

These values are plotted on Figure 1 where the minimum and maximum certified values are represented as a box. Our analytical values are plotted in Figure 1, and in every instance, our values lie inside the limits indicating a high degree of accuracy which easily meets the ICH specifications.

A second measure of accuracy is spike recovery. The “blank blood” (WB(F)) sample from UTAK was spiked with 150μL of the stock standard solution for all elements except Ca and Mg in the 15mL tube. The recovery is calculated as: 

Spike recoveries are shown in Table 4. All recoveries are within 90 – 110%, indicating excellent recovery of the spiked analytes.

Table 4: Spike Recoveries

Method precision is measured as the repeatability of six Seronorm level 2 (SRM2) samples. Six samples of Seronorm level 2 (SRM2) were prepared, diluted, and analyzed individually. The results show less than 3% RSD among the replicates. The %RSD of the six replicates is presented in Figure 2.


Figure 1: Accuracy of Certified Seronorm Material Analysis


Figure 2: Precision of Seronorm Material Analysis

The method detection limit (MDL), and limit of quantitation (LOQ) were determined using the standard deviation (σ) of the signal from eight acid diluent blanks. The acid diluent blanks were prepared using the same technique and equipment as the samples and were included at the end of each run followed by a calibration standard. The MDL and LOQ are calculated as: 

where S is the calibration slop, and:

Since the calibration slope was the analyte relative to an internal standard, the calibration standard was used to determine the counts/second/ppb. These values are calculated, multiplied by 50 to account for the dilution factor, and expressed in μg/L (ppb). In the table, the MDL and LOQ are plotted relative to physiological normal values represented by Seronorm 2 (SRM2). For most analytes, the MDL and LOQ are miniscule by comparison, particularly for the major elements calcium and magnesium. However, even for more challenging analytes such as selenium, the MDL is an order of magnitude less than Seronorm 2 (SRM2) which, despite being level 2 (SRM2), has the lowest selenium content of these three SRMs. 


Figure 3: LOQ and MDL as compared to physiological normal values
*as represented by Seronorm L2, formulated to represent typical, or average human values.

Conclusion

In this application note, we report on the analysis of trace elements in blood using the Advion Interchim Scientific SOLATION® ICP-MS. Blood is a complex and challenging matrix. However, these data support the use of a straightforward “dilute and shoot” sample preparation method that gives accurate and precise concentrations for high level and trace level elements in blood. Excellent recoveries were observed for both spiked samples and CRMs. The combination of the quadrupole deflector and the collision cell minimizes drift and ensures accuracy and precision over time. The reported method benefits from the fast collision cell gas switching capabilities of the SOLATION® to analyze a wide range of elements in blood for rapid, accurate and reproducible results.

Posted on

Analysis of Iohexol using the Advion Interchim Scientific AVANT® HPLC and expression® CMS System

Introduction

Iohexol is a widely used non-ionic imaging agent that improves contrast for x–ray analysis. Its low osmolality allows for a rapid clearance via the kidney, preventing reabsorption and further metabolization[1]. This makes iohexol a compound with a better safety profile compared to other imaging agents[2]. 

In many clinical imaging applications, imaging agents/contrast agents are administered to patients to improve the contrast and spatial resolution of the scan. Due to toxicity and side effects of imaging agent, preparations of their known concentrations and their purity analysis are very important for their safe use and accurate diagnostic. 

In this application note, a simple and accurate HPLC-CMS method for iohexol analysis is introduced.

Method

Method Setup

All solvents used in the application were HPLC grade.

Two Iohexol standards were obtained from Sigma Aldrich.

One was a certified reference material with purity of 99.99%, the second one had a stated purity of ≥ 95%.

All experiments were performed on an Advion Interchim Scientific® expression® Compact Mass Spectrometer coupled with an AVANT® UHPLC system with parameters as shown in Table 1.

Table 1: HPLC/MS Method

HPLC/UV/MS Analysis of Iohexol

At room temperature, iohexol will isomerize with two peaks detected in its HPLC/UV/MS analysis. 

These two peaks (Figure 1A) come from hindered rotation of the anilide N-acetyl group due to the bulky iodine atoms attached to the central benzene ring of the iohexol. Those two compounds are essentially “rotational isomers” that interchange slowly at room temperature in aqueous solution.

Both peaks are confirmed with MS analysis to show the same m/z at 821.9 (Figure 1B and 1C) and no difference was visible in their in-source CID mass spectra (Figure 2A and 2B). 

Since both rotamers contribute to the compounds toxicity and imaging enhancing capabilities in x-ray analysis, the sum of both peaks will be used for any further iohexol analysis in this application note. 


Figure 1: (A) HPLC chromatogram (254 nm) of iohexol, (B) The extraction ion chromatogram of protonated iohexol at m/z 821.8, (C) The averaged MS spectra from peak at RT 4.06 min.


Figure 2: (A) The averaged in-source CID mass spectra from peak at RT 3.61 min, (B) The averaged in-source CID mass spectra from peak at RT 4.06 min.

Purity Determination by HPLC/UV Analysis

By comparing the HPLC response from iohexol sample to the response of the iohexol certified standard at a similar concentration, the peak area ratio of sample to certified standard can provide a quick concentration and purity analysis. 

The equation to calculate the concentration ratio of iohexol is shown below:

The HPLC chromatograms of iohexol sample and certified reference are shown in Figure 3A and 3B.

The averaged value of summed two peak areas is 714 for iohexol sample (Figure 3A), and 740 for iohexol reference standard (Figure 3B). With the calculation of concentration ration, the calculated concentration of iohexol in the sample is 0.0964 mg/ml which equals a purity of 96.4% – in line with the stated product purity of ≥ 95%.


Figure 3: (A) HPLC chromatogram (254 nm) of iohexol sample (0.1 mg/ml) (B) HPLC chromatogram (254 nm) of iohexol reference standard (0.1 mg/ml).

Quantitation by HPLC/UV Analysis

To check the purity of an iohexol sample more accurately, a calibration curve of iohexol certified standard material was created with five different dilution levels from 25 to 500 μg/mL and with triplicate injections for each concentration. The R-squared value of the resulting linear calibration function is 0.9999 (Figure 4) showing excellent linearity. 

By way of the iohexol calibration curve approach, the purity of the iohexol sample was determined to be 97.5%. 

This value is also right above the stated purity of min 95% of the sample and differs by only 1.1% from the measured value by direct UV response ratio analysis of the iohexol sample to iohexol reference standard.

Both purity determination by way of a calibration function or by direct UV response ratio analysis can be used for organic chemicals with UV absorbances if certified reference standard material is available.

The calibration function method will provide a more accurate measurement.


Figure 4: Calibration curve of iohexol by HPLC chromatogram (254 nm)

Conclusion

The Advion Interchim Scientific AVANT® (U)HPLC system can provide accurate chromatographic methods for the purity analysis of imaging agents as shown for iohexol. Coupling UHPLC with the Advion Interchim Scientific expression® Compact Mass Spectrometer not only provides confirmations of target compounds via their mass and in-source fragmentation pattern, but also allows for rapid determination of impurities. 

REFERENCES
[1] T. Almen, Development of nonionic contrast media., Invest. Radiol. (1985) Investigative Radiology. 1985, 20(1), S2-S9.
[2] R.D. Moore, E.P. Steinberg, N.R. Powe, R.I. White, J.A. Brinker, E.K. Fishman, S.J. Zinreich, C.R. Smith, Frequency and determinants of adverse reactions induced by high-osmolality contrast media., Radiology. 1989, 170, 727-32.

Posted on

Extraction and Purification of 3 Curcuminoids from Turmeric Powder

Instrumentation:
Flash: puriFlash® XS520
TLC: Plate Express™ TLC Plate Reader
Mass Spec: expression® Compact Mass Spectrometer
Sampling: ASAP® Direct Analysis Probe

Introduction

Curcuminoids are natural polyphenol compounds derived from turmeric root (Curcuma longa). They are reported to have antioxidant activities1. Curcumin is the main curcuminoid found in turmeric. It is commonly used as an ingredient in dietary supplements and cosmetics, flavoring in culinary dishes, and a yellow-orange food coloring.

In this application note, a method to separate and purify 3 curcuminoids from turmeric powder using flash chromatography with the Advion Interchim Scientific puriFlash® XS520 Plus, TLC with mass spectrometry with the Plate Express™ TLC Plate Reader and expression® CMS is demonstrated. Fractions were identified using the Atmospheric Solids Analysis Probe (ASAP®).

Curcuminoid Extraction

The turmeric powder was weighted out (57.3 g) and transferred to a wide mouth glass bottle. Ethanol (250 mL, 200 proof) was added to the bottle and the mixture was stirred for 18 hours while covered with foil. The compounds of interest are sensitive to light. The slurry was then filtered and the filtrate was concentrated to dryness to form an amber oil (6.4 g).

Figure 1: Structures of curcuminoids.

Figure 2: Store-bought turmeric powder (left) and crude extract oil (right).

TLC/MS Analysis

The Advion Interchim Scientific Plate Express™ paired with the expression® CMS allows for easy identification of spots on TLC plates without the need for purification or sample preparation (Figure 3).

Initial TLC analysis showed 4 spots (dichloromethane:methanol, 97:3). The three lower spots were highly fluorescent, as expected for the curcuminoids of interest. TLC spots were analyzed by APCI ionization in negative ion mode. The bottom 3 spots were characterized by mass spectrometry.

Figure 3: Advion Interchim Scientific expression® CMS and Plate Express™ TLC Plate Reader (left) and close up of the TLC plate extraction head (right).

Figure 4: Developed TLC plate visualized at 365 nm. Resulting mass spectra of cur cumin (top), demethoxycurcumin (middle), and bisdemethoxycurcumin (bottom).

Flash Purification

An isocratic method was used as the separation shown on TLC was optimal as is. The crude material was purified on a 25 g, 15 μm spherical silica gel column (PF-15SIHC-F0025). A crude weight of 64 mg was dry-loaded onto 500 mg of silica gel and loaded into a 4 g dryload cartridge (PF-DLE-F0004).

Figure 5: Resulting flash chromatogram from developed TLC Plate.

Fraction Identification by ASAP®/CMS

The expression® CMS with the ASAP® Direct Analysis Probe allows for easy identification of compounds without the need for LC/MS or sample make-up.

The pure fractions (1.1, 1.3, and 1.5) were analyzed using the ASAP® probe with APCI ionization and positive polarity CMS. The curcuminoids ionize well in both APCI positive and negative polarity, however (M+H)+ ions showed less fragmentation. The detected masses are consistent with the theoretical [M+H]+ m/z values.

Figure 6: Advion Interchim Scientific ASAP® Direct Analysis Probe being inserted directly into the APCI-enabled ion source of the expression® CMS.

Figure 7: Mass spectra of fractions.

The purified fractions were concentrated to dryness to give solids I (14.1 mg), II (5.6 mg) and III (6.7 mg) respectively, which represents Curcumin (I), demethoxycurcumin (II), and bisdemethoxycurcumin (III) at 53.4%, 21.2%, and 25.3% of the isolated curcuminoid profile. These results are consistent with reported literature values2.

Confirmation of Compound Purity by RP-HPLC

Figure 8: UV Scan of purified fraction mixture.

Reverse Phase High Performance Liquid Chromatography (RP-HPLC) allows for a separate confirmation of compound purity after flash chromatography. An equal mixture of all three compounds was combined and run on a Phenomenex Kinetex® 5 μm Biphenyl 100 Å 50 x 2.1 mm column using isocratic ACN:Water (v:v, 55:45) with 0.2% formic acid. As expected, the elution order of the three curcuminoids changed order with now eluting III, II and I (Figure 8). After developing this method, the respective single collected fraction was injected and analyzed for purity and again confirmed by MS analysis.

Figure 9: UV Scan and mass spectrum of Curcumin Fraction 1.1.

Figure 10: UV Scan and mass spectrum of Curcumin Fraction 1.3.

Figure 11: UV Scan and mass spectrum of Curcumin Fraction 1.5.

Conclusion

With a combination of TLC chromatography, flash chromatography and mass spectrometry support at various stages of the process (TLC plate identification, fraction confirmation and secondary purity analysis), we can purify curcuminoids from Turmeric powder at confirmed purity levels of >95%.

References:
1Jayaprakasha et al. Antioxidant activities of curcumin, demethoxycurcumin and bisdemethoxycurcumin. Food Chemistry, Volume 98, Issue 4, 2006, Pages 720-724. ps://doi.org/10.1016/j.foodchem.2005.06.037.
2Praveen et al. Facile NMR approach for profiling curcuminoids present in turmeric, Food Chemistry, Volume 341, Part 2, 2021, 128646, https://doi.org/10.1016/j. foodchem.2020.128646.

Posted on

Soil Analysis using the Advion Interchim Scientific SOLATION® ICP-MS

Introduction

Environmental contaminants generated by human or industrial activities often find their way to the soil via runoff waters or deposition from the air. These contaminants can be taken up by plants and move up the food chain leading to potentially significant impacts on human and animal health. Therefore, it is not only important to monitor the levels of essential nutrients in the soil that are key for healthy plant growth, but it is also imperative that the levels of contaminants are monitored.

In this application note we present a method for routine analysis of 21 elements using the SOLATION® Inductively Coupled Plasma Mass Spectrometer (ICP-MS). A group of unknown soil samples and a CRM were digested using EPA 3051a and analyzed according to method 6020a requirements.

Experiment

Reagents and Materials
• Nitric acid (Aristar Plus, trace metal grade)
• Hydrochloric acid (Aristar Plus, trace metal grade)
• Water, type 1 (18.2 MΩ, Elga point of use system or equivalent)
• NIST CRM2706 “New Jersey Soil, Organics and Trace Elements”
• Spex ‘CL-ICV-1’ multi-element solution
• Aluminum standard solution (1000 μg/ml, Claritas ppt grade)

Instrumentation
1. Anton Paar Multiwave 5000 with the 20SVT50 rotor (20 position, 50mL vessels that vent at 40 bar (580 psi)
2. OKF high speed multi-function grinder
3. Advion Interchim Scientific SOLATION® ICP-MS

Standards

Calibration standards were prepared in the same acid proportions as the digested samples (9mL HNO3+ 3mL HCl, or 3:1). One liter of 3% HNO3+ 1% HCl was made as the diluent for standards, for the final dilution of samples, and to use as a calibration blank.

Standards were made using the Spex multi-element solution ‘CL-ICV-1’ and the single element Aluminum standard. Aluminum was added separately to the mix to account for the high levels of this element in soil.

Samples and Preparation

Four soil samples were dried at 60°C overnight, then finely ground using an OKF high speed multi-function grinder to make a homogeneous mixture. As per EPA method 3051a “Microwave assisted acid digestion of sediments, sludges, and soils”, 0.5 g of each sample were transferred to microwave vessels and mixed with 9mL nitric and 3mL hydrochloric acids. The vessels were then capped and run using the method outlined in Table 1. After digestion the samples were filtered, brought to volume with deionized water in a 50mL volumetric. A 1.0mL aliquot was then diluted to a final volume of 50mL with the prepared diluent for a nominal final dilution of 5,000x depending on the initial sample weight.

Table 1: Microwave Digestion Program.

For QC purposes the four unknown soil samples were prepared as a sample, duplicate, and spike. They were independently digested where the first two were used to compare the repeatability of the sample preparation, while the third one was spiked prior to the digestion to establish analyte recovery of the digestion procedure.

To verify the accuracy of the results, we included the standard reference material, NIST 2706 “New Jersey soil, organics and trace elements”, which includes certified values for all analytes reported in this study.

The samples were analyzed using a SOLATION® ICP-MS. The SOLATION® instrument configuration for this analysis was a cyclonic spray chamber with a Micromist® concentric nebulizer and a one-piece torch. Ni sampler and skimmer cones were used throughout the study. The plasma operating parameters were:

Table 2: Plasma Operating Parameters.

ICP-MS Method

Integral to the SOLATION® ICP-MS is an octupole collision cell that is used for addressing interferences from polyatomic ions, especially for the transition metal elements. It is critical for robust and routine trace element analysis that the octupole cell does not become contaminated which could cause drift and unnecessary downtime. Therefore, the ion path of the SOLATION® ICP-MS was designed to have the collision cell out of the direct line of the plasma. Ions passing through the interface are directed through a 90 ̊ turn and focused onto the entrance of the octupole using a quadrupole deflector (QD). Light and neutral particles continue through the QD and away from the cell.

The collision cell in the SOLATION® ICP-MS can be operated in “He Gas” mode in which the cell is filled with He to act as a collision gas, or in “No Gas” mode in which the cell is empty. The “He Gas” mode is used for isotopes subject to polyatomic interferences while the “No Gas” mode is used for the rest of the isotopes. The rapid switching between “He Gas” and “No Gas” modes on the SOLATION® (< 5 sec) ensures that analytical runs can be kept short, thereby improving productivity.

The helium flow used for “He Gas” mode in this application was 6 ml/min. Table 3 lists the elements used for this analysis and their isotopes, and the mode used for each.

Table 3: A list of the elements included in this study together with their isotopes and the gas mode used for the analysis.

Results and Discussion

The results summarized in Figure 1 show excellent agreement between the measured data for CRM2706 and the reported extracted levels for these elements. A slightly higher recovery was observed for K and Al, possibly due to variability in the extraction efficiency of this digestion method.

Figure 1: Certified reference material recovery data.

As shown in Table 4 spike recoveries averaged between 75% and 125% for all elements, with the exception of Al; This was likely due to the small size of the spike compared to levels of Al in the samples. Included in the same table are the results from the duplicate digestions/analyses for these elements. On average, the duplicates were less than 20% apart with most elements showing excellent repeatability of <5%.

Table 4: Average spike recoveries and duplicate repeatability for the various samples.

Summary

In this application brief we report on the analysis of trace elements in soil using the Advion Interchim Scientific SOLATION® ICP-MS. Excellent recoveries were observed for both spiked samples and CRMs. The combination of the quadrupole deflector and the collision cell minimizes drift and ensures accuracy and precision over time. The reported method benefits from the fast collision cell gas switching capabilities of the SOLATION® to analyze a wide range of elements in soil for rapid, accurate and reproducible results.

Posted on

Mass Directed Fraction Collection of Natural Products: Examples from Turmeric and Green Tea Extract

Flash: puriFlash® 5.250
Mass Spec: expression® CMS
Sampling: ASAP® probe

Introduction

Flash chromatography has traditionally used UV absorption as the main method of detection for compounds during a purification process. While UV absorption is broadly applicable to many classes of compounds, it has limited specificity to individual compounds in a mixture and misses classes of compounds that do not carry chromophores.

Mass-directed fraction collection gives users the ability to collect fractions based on mass spectrometry detection (MS) which is based on ions specific to individual compounds and provides specific molecular information. This allows for simplification in the overall purification process and greater confidence in the identity of each isolated compound.

Here we describe methods of isolating natural products from green tea and turmeric powder by mass-directed fraction collection during flash chromatography and preparative LC. For demonstration purposes, the isolated compounds were then additionally confirmed by Atmospheric Solids Analysis Probe (ASAP®) MS or HPLC-MS.

Introduction to Curcuminoids

Curcumin is the main curcuminoid found in turmeric root (Curcuma longa). It is commonly used as an ingredient in dietary supplements and cosmetics, flavoring in culinary dishes, and a yellow-orange food coloring. Curcuminoids have been reported as having antioxidant and anti- inflammatory activities.

Store-bought turmeric powder (57.3 g) was extracted in ethanol, then filtered through filter paper, and concentrated. This yielded a crude extract oil of 6.4 g containing the three curcuminoids of interest (also compare TLC analysis in Figure 4).


Figure 1: Structures of the curcuminoids of interest.


Figure 2: Store-bought turmeric powder.


Figure 3: Crude extract oil from turmeric powder.


Figure 4: TLC analysis at 365 nm of turmeric extract (97:3 DCM:MeOH) and the chromatogram of the method transferred to the puriFlash® 5.250 using UV detection.

Method Development

The turmeric extract was first analyzed on a TLC plate and then the method transferred to the puriFlash® 5.250 system using UV detection at two wavelengths. Four compounds were detected at 254 nm with three assumed curcuminoids detected at 427 nm, however, there is no specificity for the individual compounds in UV detection.

An isocratic method (97:3 dichloromethane:methanol) was used as the separation shown on TLC was optimal. The crude material was purified on a 12g, 15 μm spherical silica gel column (PF-15SIHC-F0012). A crude weight of 32 mg was dry-loaded onto 250 mg of silica gel and loaded into a 4g dryload cartridge (PF- DLE-F0004). Fractions were collected using the XIC channels for each compound of interest.


Figure 5: Screenshot of the flash chromatography method run with parameters.

The mass spectrometer settings are controlled through the InterSoft®X software on the puriFlash® system. The mass spectrometer was fitted with an APCI source and run with negative ionization acquisition mode.


Figure 6: Screenshot of the mass spectrometer parameters for chromatography run.

Experiment

Mass-Directed Fraction Collection

The extracted ion chromatogram (XIC) created by plotting the intensity of the observed signal at a chosen mass-to- charge value. This allows for a low-noise signal of compounds of interest. Here the XIC channels are set to detect the three curcuminoids of interest.


Figure 7: TLC Analysis of turmeric extract (97:3 DCM:MeOH) and chromatogram of method transferred to the puriFlash® 5.250 using MS XIC detection.




Figure 8: The mass spectra for each peak as provided by the puriFlash® InterSoft®X software.

ASAP® MS Fraction Confirmation

The pure fractions (1.1, 1.2, and combined 1.3 and 1.4) were additionally analyzed using ASAP® negative polarity MS. The detected masses are consistent with the theoretical [M-H]- m/z values.




Figure 9: The mass spectra of the isolated compounds confirming their identity and purity.

Introduction, Green Tea Catechins

Dry green tea typically consists of 10-30% of polyphenols based on dry weight with catechins being the major tea polyphenols including: (−)-epigallocatechin (EGC), (−)-epigallocatechin-3-gallate (EGCG), (−)-epicatechin- 3-gallate (ECG) and (−)-gallocatechin gallate (GCG). EGCG is the most abundant and biologically active catechin, separating and purifying catechins from raw tea extract can greatly increase their market availability and value.

Dry green tea leaves were extracted into hot water, then partitioned with ethyl acetate, filtered through filter paper, and evaporated to give a crude extract. The dry extract was then dissolved in 7.5 mL of water and filtered with 0.2 μm filter before further processing.


Figure 10: Green tea leaves steeping.


Figure 11: Major Catechins in Green Tea.

Method Development
With HPLC-UV/MS analysis, EGC, EGCG, GCG, EC and ECG are detected in the tea extract (Figure 12).

Solvent A: Water
Solvent B: Methanol
UV: 275 nm
MS: full scan from 150-900
Column: US15C18HP-250/046


Figure 12: The HPLC-UV chromatogram of green tea extract, MS data and a standard for EGCG was used for compound confirmation (data not shown).

The mass spectrometer settings are controlled through the InterSoft®X software on the puriFlash® system. The mass spectrometer was fitted with an ESI source and run with negative ionization acquisition mode.


Figure 13: Screenshot of the mass spectrometer parameters for chromatography run.

Mass-Directed Fraction Collection
Here the XIC channels are set to detect the 4 catechins of interest. EGCG and CGC are isomers and therefore share the same mass.


Figure 14: Chromatogram of the method transferred to the puriFlash® 5.250 using MS XIC detection.


Figure 15: The mass spectra for each peak as provided by the InterSoft®X software.

Conclusion

• With natural products isolation, one of the biggest challenges is the identification of compounds of interest in complex extract mixtures.
• Using MS and chromatography in tandem we can separate and identify compounds in a complex mixture with a high degree of purity and accuracy without the need for further identification of fractions collected.
• The fractions collected can be characterized directly through the MS data provided by the InterSoft®X software on the puriFlash® systems.
• The puriFlash® 5.250 and expression® CMS make a powerful duo in the purification and identification of natural products such as the catechins found in green tea and the curcuminoids found in turmeric.

Posted on

High-Throughput Purification of Five Over-the-Counter & Prescription Drug Compounds by Reverse-Phase Preparative LC-MS

Instrumentation:

puriFlash® 5.250
expression® CMS
Uptisphere® StrategyTM column US5C18HQ-150/300

Authors:

Advion Interchim Scientific, Montluçon, France Headquarters

 

Introduction

Purification is a critical step in drug development. From research, to scale-up to process, purification and confirmation are essential steps in bringing a drug to market. It is essential to have a high-throughput solution that offers sufficient quantity and reproducible quality of purified compounds. The separation of the active pharmaceutical ingredients (APIs) from their impurities can be easily achieved with a preparative chromatography system.

This application note features the purification of five active ingredients found in over-the-counter (OTC) drugs including caffeine, glafenine, ketoprofen, flavone, and fenofibrate (Figure 1), by a preparative purification workflow with confirmation using a compact mass spectrometer.

Figure 1: The five compounds of interest include caffeine, glafenine, ketoprofen, flavone, and fenofibrate. Chemical structures and pharmaceutical use cases are highlighted below.

Caffeine: A natural chemical with stimulant effects, caffeine can be found purified in tablet form, or naturally occurring in coffee, tea, cocoa and more.

Glafenine: A nonsteroidal anti-inflammatory drug (NSAID), glafenine was removed from the market in 1991 due to a high risk of anaphylaxis.

Ketoprofen: A prescription-based nonsteroidal anti- inflammatory drug (NSAID), ketoprofen is used to treat inflammation, swelling, stiffness and joint pain. The drug was discontinued in 1995 due to increased risk of heart attack, stroke, irritation and other issues.

Flavone: A metabolite and nematicide that commonly exists in plants.

Fenofibrate: A prescription medication used to reduce and treat high cholesterol and triglyceride (fat-like substances) levels in the blood.

Experiment

Exploratory LC Separation

Figure 2: To confirm the presence of the pre-identified compounds, an exploratory LC-UV run confirmed the presence of the drug compounds prior to purification.

Preparative LC Run

Following the positive ID of the five compounds of interest and their elution points, the drug mixture was then ready for a preparative LC-UV run on the puriFlash® 5.250 iELSD. The purification is aided by the iELSD pack, enabling the detection of chromophore-free compounds (Figure 3).

Results and Validation

Separation & Purification Results

The identity of the separated compounds was confirmed using the Advion Interchim Scientific expression® Compact Mass Spectrometer, quickly and accurately identifying the compounds of interest.

The purity of these compounds can be verified using analytical scale HPLC.

Posted on

SOLATION®, A New ICP-MS for the Detection of Heavy Metals in Cannabis and Hemp

Introduction

Cannabis and hemp products are becoming much more available for medicinal and recreational use making routine testing for toxic heavy metals much more important.  Advion Interchim Scientific introduces the SOLATION® ICP-MS for the analysis of heavy metals in cannabis plant and cannabis product samples.  While there are no federal guidelines for heavy metals in cannabis, states where cannabis use and production are legal have adopted exposure limits and QC criteria for Arsenic, Cadmium, Mercury, and Lead based on USP<233>.  Here, we report the results of our sample analysis using these guidelines. 

Methods

Cannabis flower was purchased locally and finely ground for analysis.  Samples are prepared using a microwave digestion system (CEM Mars 6, Matthews, NC).   Method validation for USP<233> is based on accuracy, using spike recoveries, repeatability based on the %RSD of six independently digested replicate, and ruggedness, where those 6 replicates are run a second time by another analyst, another instrument, or on another day.  The spike levels are based on the “action level” defined by the California maximum permitted daily exposure (PDE) limits as a guide:  Lead 0.5 µg/g, Arsenic and Cadmium 0.2 µg/g, and Mercury 0.1 µg/g are used to define the 100% spike level.  Samples are also spiked at 50% and 150% of the action level. 

Preliminary Data

For digestion, 0.5 g (+/- 0.002g) of sample is treated with 9mL conc. HNO3 and 1mL conc. HCl in a microwave vessel and allowed to react for 15 minutes prior to being capped.  The vessels are loaded onto the carousel in the microwave and the “one touch” cannabis method, supplied by CEM, is used.  Samples are brought to 200°C in 30 minutes, held there for 10 minutes, and allowed to cool.  The result is a clear, particle free solution. The SOLATION® ICP-MS was used to analyze the samples for As, Cd, Hg, and Pb after digestion and dilution.  The results show that the SOLATION® ICP-MS was able to produce accurate values as measured by the spike recoveries which were well within the 70-150% range.  The results from the 6 independent digests were within the defined limit of 20% RSD.  Repeat analysis of the 6 digests on a separate day showed good agreement with the initial results and were within the 25% RSD spec. defined by USP<233>.  Overall results show that the SOLATION® ICP-MS is an effective instrument for the analysis of cannabis and hemp samples.